FrameView Instructions


To use the FrameView software package,  download 
the two files 

FrameView.exe 
chartdir30.dll  

and place them both in the same folder on your 
WINDOWS machine.  

You will need a DNA or RNA sequence as input.  It 
should be in the form of a text (ASCII) file.  

The sequence can include the symbols 

a, c, g, t, u, 
A, C, G, T, U,

and also newlines,  spaces,  and digits.  

For example,  an acceptable input would be 
a file containing the following single line: 

gaggcttcttctacacacccaagacccgccgggaggcagaggacctgcaggtggggcagg



Or a file containing the following two lines: 

tgcagaagcg tggcattgtg gaacaatgct gtaccagcat ctgctccctc taccagctgg
agaactactg caactagacg cagcccgcag gcagcccccc acccgccgcc tcctgcaccg


Or a file containing the following eight lines:  

        1 gctgcatcag aagaggccat caagcacatc actgtccttc tgccatggcc ctgtggatgc
       61 gcctcctgcc cctgctggcg ctgctggccc tctggggacc tgacccagcc gcagcctttg
      121 tgaaccaaca cctgtgcggc tcacacctgg tggaagctct ctacctagtg tgcggggaac
      181 gaggcttctt ctacacaccc aagacccgcc gggaggcaga ggacctgcag gtggggcagg
      241 tggagctggg cgggggccct ggtgcaggca gcctgcagcc cttggccctg gaggggtccc
      301 tgcagaagcg tggcattgtg gaacaatgct gtaccagcat ctgctccctc taccagctgg
      361 agaactactg caactagacg cagcccgcag gcagcccccc acccgccgcc tcctgcaccg
      421 agagagatgg aataaagccc ttgaaccagc



This is just the sequence taken from a Genbank entry.  Note 
that FrameView will ignore the numbers,  the spaces,  and 
the newlines.  

=================================================

If you wish to analyze a sequence from Genbank,  simply download 
the Genbank entry,  and save the sequence part of the entry 
(the last few lines) as a separate file.  You might find it 
convenient to label the file with the Genbank accession number, 
since the name of the file will appear as the title on the 
graph generated by FrameView.  

If you have a sequence that is not in Genbank,  simply create 
a text file containing it (with or without spaces,  newlines,  
and numbers).  

=================================================

If you provide as input a file that contains other symbols,  
FrameView will still analyze it,  ignoring the other symbols but 
remarking in its command window that an unexpected character 
was encountered. 

However,  this is not a good practice.  If,  for example,  you 
feed it an entire Genbank entry (without editing out the material 
before the sequence),  it will analyze the entire entry.  Any 
a, c, g, t, or u symbols will be regarded as part of the 
sequence.  You will not easily be able to tell where the actual 
sequence begins.  

=================================================

To use FrameView,  double-click on the FrameView icon 
on your WINDOWS desktop.  It will prompt you for the 
name of the file containing the sequence you wish to 
analyze.  Type in the name and push <ENTER>. 

FrameView will analyze your input sequence and create 
one or more graphs.  If the input was a file named 

inputfile

then the output will be a file named

inputfile.graph

It will contain a graph showing the coefficients for the 
sequence in the different frames.  The horizontal axis is 
measured in base pairs,  and accommodates 1500 bp.  If the 
sequence is more than 1500 bp long,  then the output will 
be two or more graphs,  in files named 

inputfile.graph1
inputfile.graph2

and so on,  as required.  


=================================================

The output graphs show the coefficients required to match 
portions of the given sequence with the expected codon 
frequencies in the six possible reading frames.  Positive 
coefficients are shown in blue,  negative ones in red.  

A good match to a particular frame will show up as a 
section with a considerable row of mostly blue in one frame 
and mostly relatively small bars in the other five.  

=================================================